Hasil cek similarity" The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy"

Salamah, Nina and Yuny Erwanto, Yuny and Martono, Sudibyo and Rohman, Abdul (2021) Hasil cek similarity" The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy". Indonesian Journal of Chemistry. ISSN 1411-9420 / 2460-1578

Text 14.HASIL CEK_Nina Salamah, Yuny Erwanto, Sudibyo Martono, and Abdul Rohman.pdf Download (2MB)

Abstract

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Item Type:	Artikel Umum
Subjects:	R Medicine > RS Pharmacy and materia medica
Divisi / Prodi:	Faculty of Pharmacy (Fakultas Farmasi) > S1-Pharmacy (S1-Farmasi)
Depositing User:	Ms Nina Salamah
Date Deposited:	26 Oct 2022 07:42
Last Modified:	26 Oct 2022 07:42
URI:	http://eprints.uad.ac.id/id/eprint/37362

Actions (login required)

View Item